<?xml version='1.0' encoding='UTF-8'?><?xml-stylesheet href="http://www.blogger.com/styles/atom.css" type="text/css"?><feed xmlns='http://www.w3.org/2005/Atom' xmlns:openSearch='http://a9.com/-/spec/opensearchrss/1.0/' xmlns:georss='http://www.georss.org/georss' xmlns:gd='http://schemas.google.com/g/2005' xmlns:thr='http://purl.org/syndication/thread/1.0'><id>tag:blogger.com,1999:blog-1479329177592025809</id><updated>2012-01-30T03:18:48.919-08:00</updated><title type='text'>Les Ey</title><subtitle type='html'></subtitle><link rel='http://schemas.google.com/g/2005#feed' type='application/atom+xml' href='http://les-ey.blogspot.com/feeds/posts/default'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1479329177592025809/posts/default?max-results=100'/><link rel='alternate' type='text/html' href='http://les-ey.blogspot.com/'/><link rel='hub' href='http://pubsubhubbub.appspot.com/'/><author><name>Les</name><uri>http://www.blogger.com/profile/05561653336505981873</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><generator version='7.00' uri='http://www.blogger.com'>Blogger</generator><openSearch:totalResults>4</openSearch:totalResults><openSearch:startIndex>1</openSearch:startIndex><openSearch:itemsPerPage>100</openSearch:itemsPerPage><entry><id>tag:blogger.com,1999:blog-1479329177592025809.post-8811911763639492454</id><published>2008-01-01T16:30:00.000-08:00</published><updated>2008-01-13T18:49:21.775-08:00</updated><title type='text'>Complicated Data Copying Systems: A Problem for Evolution</title><content type='html'>&lt;span style="font-weight:bold;"&gt;Introduction&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;In this article I would like make one thing as clear as a possibly can, that systems that can copy information automatically are &lt;span style="font-style:italic;"&gt;very&lt;/span&gt; complicated systems. For any system that can copy information accurately and automatically to exist, some very complicated engineering problems need to have been solved. A system like that requires one or more designers with the capacity to think through the issues. A system like that could not have come about by chance alone.&lt;br /&gt;So before I go any further I would like to define the word replication. &lt;br /&gt;Replication: Making a copy of something. &lt;br /&gt;So the word “replication” is just a fancy word for making a copy of something. &lt;br /&gt;So automated database replication systems copy information from one database to another and do so automatically (i.e. Without needing a user to control it all the time). &lt;br /&gt;I work as a computer programmer and I worked on a team that designed and wrote an automated database replication system that was used to copy information from a central site to sites in the Asia/Pacific region. These sites had to be up and running 24/7, so all changes (including software upgrades) had to occur with minimal disruption to the call centres that used the data. (At least that was the plan).&lt;br /&gt;The Internet was not as fast or reliable as it is today, so that meant that the system had to work over slow dial-up connections and that made the task even more challenging. The type of database that we worked with was not as robust as ORACLE (a popular database system) and did not have it’s own built in replication or scheduling systems. But even back then when I would tell another programmer what I was doing, the reaction would as if they (even programmers) thought that what I was doing should be easy. It was not easy, I spent nine months in Sydney just installing and customising the system just for one client.  &lt;br /&gt;I hope to show you some of the main problems that must be dealt with using as non-technical a language as I can and then relate these issues to replication in living cells and show that living cells must have had a very Intelligent Designer.&lt;br /&gt;&lt;br /&gt;&lt;span style="font-weight:bold;"&gt;So why is live automated replication difficult to achieve?&lt;/span&gt;&lt;br /&gt;To outline it, here is a list of the issues followed by a more detailed explanation.&lt;br /&gt;&lt;br /&gt;  Automatic Scheduling&lt;br /&gt;  Correct Timing &lt;br /&gt;  Correct Sequence &lt;br /&gt;  Feedback - Resending Lost Information&lt;br /&gt;  Error detection &lt;br /&gt;  Disaster recovery – rebuilding entire database files&lt;br /&gt;  Live upgrading while ‘on-line’ 24/7&lt;br /&gt;&lt;br /&gt;&lt;span style="font-weight:bold;"&gt;Automatic Scheduling&lt;/span&gt;&lt;br /&gt;There are two words that I have come to dread as a programmer. One is ‘generic’ and the other is ‘automatic’.&lt;br /&gt;There is no easy way that I can impress on you the load of tension that is packed into the word ‘automatic’ when I hear it in a context like ‘you must write a program that will do several tasks automatically’. &lt;br /&gt;Software developers cop a lot of flack because of the tendency for projects to go overtime and over budget. A good way of sending projects overtime and over budget is insert the word ‘automatic’ into the design specification in several places.   &lt;br /&gt;To put this in every day terms, let’s just take something that is basic for a human being such as crossing a road safely. If you really want to appreciate what a major design achievement crossing a road is, then try building a robot that has the capacity to take the visual data from two cameras and use it to determine not just whether or not there is something on the road but where it is, how fast it is going and whether or not it is on a collision coarse with the robot.&lt;br /&gt;If you can design a system that can just tell that there is something there at all, then you have done well.&lt;br /&gt;I have not designed a system like that myself and I don’t plan to, it is sufficient for me to read books like one by robotics guru, Rodney Brooks, (Flesh and Machines: How Robots Will Change Us) to get a good idea of how hard that can be.&lt;br /&gt;However the information copying system that I worked on did have to run automatically and that meant that it had to be able to make decisions and allow for eventualities all by itself without waiting for a user to type ‘Y’, ‘N’ or hit the ‘Enter’ key. &lt;br /&gt;I could write a whole article on scheduling alone, in fact the scheduling software that we used for the replication system was a separate system in itself. Just making changes to the scheduling software to get to work with the replication software took a great deal of time. Anyhow to cut a long story short let me just say that for the replication system to work automatically it needed scheduling software that was complicated enough in its own right.&lt;br /&gt;&lt;br /&gt;&lt;span style="font-weight:bold;"&gt;Correct Timing&lt;/span&gt;&lt;br /&gt;One of the issues of the scheduling of a replication system involves getting the interval between replications right. The information had to be as up to date as possible but that had to be balanced with the fact that if the system replicated too often it would go over a threshold and become hopelessly overloaded. So the replication packets waiting to be delivered and applied would just keep building up and nothing would be replicated on time. That meant that there were two competing constraints (goals) and that the system had to be optimised to suit both constraints.&lt;br /&gt;&lt;br /&gt;&lt;span style="font-weight:bold;"&gt;Correct Sequence&lt;/span&gt;&lt;br /&gt;Information had to be copied to the remote sites in the correct order or the information would be potentially misleading. For example, suppose an operator in the call centre received an order for an item and that there were two items in stock, after the purchase there would be one item left. Now suppose another operator receives an order for the same item leaving no more items at all.&lt;br /&gt;The information that is replicated would look like, ‘there is one item left’ and then ‘there are no items left’. But suppose that the information that there are no items left gets copied first and then the information that there is one item left gets copied after that. An operator at the overseas call centre will then check the availability of the item and think that there is one item left to sell! That’s not good! To have a useful replication system the system needs to keep track of what has been done and apply the changes in the correct order. &lt;br /&gt;&lt;br /&gt;&lt;span style="font-weight:bold;"&gt;Feedback - Resending Lost Information&lt;/span&gt;&lt;br /&gt;If the remote site tries to apply changes to the database and one of the packets of information has gone missing, the remote site then needs to be able to send a message back to host site asking for it to try sending the information again but once the information has been received the remote site can tell the host site that all is ok and that it no longer needs to keep its own copy of that information packet for that particular site.&lt;br /&gt;&lt;br /&gt;&lt;span style="font-weight:bold;"&gt;Error detection&lt;/span&gt;&lt;br /&gt;To be absolutely confident that our system was 100% accurate we needed to be able to compare the information on the host site with that on the remote sites. So our system also had a separate module that would compare all the remote sites with the host site and then ask the host to send any information that had been lost or that was inaccurate. That took one paragraph to describe in English but it took careful thought and planing along with many of lines of computer code (that took a lot of time to write) in order to get the error detection system working.&lt;br /&gt;&lt;br /&gt;&lt;span style="font-weight:bold;"&gt;Disaster recovery – rebuilding entire database files&lt;/span&gt;&lt;br /&gt;There were things that could go wrong with the system that were entirely out of our hands, such as a major file corruption caused by a power outage. In that case entire files of information had to be rebuilt. Again this is fairly easy to describe but much harder to do.&lt;br /&gt;&lt;br /&gt;&lt;span style="font-weight:bold;"&gt;Live upgrading while ‘on-line’ 24/7&lt;/span&gt;&lt;br /&gt;This was a nightmare. There were no scheduled downtimes because any downtime meant the call centre could not take calls and that profit would be lost. That meant that the software needed to be able to upgrade itself while it was running. At least that is how it was supposed to work, the occasional version mismatch with something not working correctly with something else would cause the replication system to come to a halt. &lt;br /&gt;&lt;br /&gt;&lt;span style="font-weight:bold;"&gt;The Implications&lt;/span&gt;&lt;br /&gt;In a few paragraphs I have outlined some of the issues that had to be dealt with and it almost sounds easy when I describe them like that. Let me assure you that there is a world of pain in some of those issues. Like getting after hours calls because the ‘system is down’. Like sitting in meetings that go for over an hour just trying to resolve problems like how to make sure that a call centre site gets only the information relevant to it and how the people in the head office get their sales information and how the warehouse ends up with the orders and nobody gets too much unneeded information. This article could become a book if I was to go into all the issues and spell out what makes these issues so difficult to solve. I have mentioned just a few of the issues, the kind of issues that can have a room full of IT professionals tearing their hair out for hours. As I said before when setting the correct interval between replications there were two competing requirements that needed to be considered. The system needed to be optimised to achieve the most efficient result. Optimisation is easy when there is only one requirement but when there are two competing requirements it starts to get a little tricky. &lt;br /&gt;When there are pros and cons to weight up for various solutions to a problem, you can find yourself in one of those meetings arguing in circles. One thing is for sure; these problems are not dealt with except through careful thought and planning. Automatic information copying systems do not engineer themselves and the complex issues that go with systems like that are seldom solved by using the first idea that comes to mind let alone by blind chance. The main issue with an automatic system is that it has to be designed to make decisions for itself and since computers can’t think for themselves, the programmer has to do all the thinking ahead of time and build all of that logic into the system. Lack of foresight will result in bugs. For example, lets imagine that someone puts password protection on a database file, the replication software tries to access it but it is has not be designed to use a password, it will inadvertently get a ‘permission denied’ message. The programmer may well have thought it reasonable to assume that the replication software would always have access to this file so they don’t allow for it in when they write the program. The program can’t think for itself so it just sits there with a ‘permission denied’ message showing on the screen waiting for a user to fix the problem. The last thing you want when a system is automatic is for it to sit there waiting for a user to respond.&lt;br /&gt;Having said all that, there may still be some people with programming experience who would think I’m making a mountain out of a molehill. All I would say to them is that today we can use solid database systems with built in replication that run on fast and reliable servers that communicate across fast and reasonably reliable networks but try telling all the programmers and engineers who made it possible for us to take all that for granted that their work is trivial and must have been very easy. If you can get them all to agree with that then let me know and I’ll rewrite this article accordingly.&lt;br /&gt;The fact is that information systems are brittle, it does not take much to break them and a lot of work needs to be done before you can trust them. &lt;br /&gt;So how brittle can it be? Image being in a call centre where about twenty operators are taking calls from customers and you are at a terminal and you hit one key at the wrong time and for the next hour every one of those operators will be telling potential customers that they are sorry but the computer is down and now you have to go a tell the IT manager why the system is down. That happened to me. My point is that information systems can be very easy to break, they are hard to design and they are not the result of chance. &lt;br /&gt;&lt;br /&gt;&lt;span style="font-weight:bold;"&gt;Living Cells&lt;/span&gt;&lt;br /&gt;So what has all that got to do with living cells? &lt;br /&gt;The fact is that living cells are miniaturized information copying systems that run 100% automatically and are ‘online’ 24/7 and the system that I worked on is not even a toy in comparison. Imagine a computer that could take in resources from it’s environment (just the resources it needed and avoid things that are harmful), imagine if that computer could make an exact copy of it’s mother board, the CPU, the power supply, the hard drive (including all the files on it) stretching it’s case while all this was happening and then splitting into two computers that were both up and running at the end of all that. That would still not match the complexity of a living cell. To paraphrase Michael Denton from his book ‘Evolution a Theory in Crisis’, if you could photograph a living cell and blow the photograph up so that the photo stretched for several miles, you would still see minute detail in every part of the photograph. That is complexity that matches the complexity of a city. In Darwin’s Black Box, Michael Behe describes some of the irreducibly complex systems that make up a living cell and one of them is like a parcel delivery system that sends what is needed within a cell to the exact place where it is needed.&lt;br /&gt;A cell has mind-blowing complexity and the known complexity just increases with each new discovery. The more you learn the more complex it gets. It blows my mind to learn that a cell caries out its own replication while it is still up and running. It has machines that unwind the strands of DNA, machines that copy those strands and the same machine can check for it’s own mistakes and correct them (only missing a very tiny percentage of the mistakes). The membrane of cell nucleus dissolves during replication and the two pairs of chromosomes of DNA are split apart by machines that look like rods that push them into the areas what will become the daughter cells.&lt;br /&gt;All this has critical timing; you don’t want to push the chromosomes apart before they are ready. In fact timing is everything throughout the entire process. &lt;br /&gt;When I see a DVD like ‘Unlocking the Mystery of Life’ that illustrates some of these incredibly complex processes using animation, it yells &lt;B&gt;‘DESIGN’&lt;/B&gt; at me. If that is not enough, the cell has it’s own disaster recovery system. When DNA is damaged, machines in the cell detect the damage and repair it.&lt;br /&gt;This all happens automatically. There’s that word that give me nightmares when I have to write software but when I’m looking at a living cell the same word makes me awestruck.&lt;br /&gt;Every single engineering problem that an automated information replication system can face has either been solved or bypassed in the design of a living cell. &lt;br /&gt;&lt;br /&gt;&lt;span style="font-weight:bold;"&gt;Is the fact that I can write automatic replication software proof that this can happen as the result of natural processes alone?&lt;/span&gt;&lt;br /&gt;My work has only reinforced my belief that God must have designed life.&lt;br /&gt;My work is a toy in comparison and there is no way that a system like the one that I wrote could just happen. The model best fits the intelligent design model because the system I wrote required planning and thought, lack of planning resulted in bugs.  A living cell is a vastly superior design that is 100% automatic. The fact that it is so difficult to make live upgrades to a working system only heightens my scepticism that a series of lucky copying mistakes can somehow avoid ‘version incompatibility’ issues and ultimately add new information or function to the system. Especially when the systems are so complex and interdependent.&lt;br /&gt;Now for the knock out blow. How do evolutionists explain systems that are as complex as this? They say that they evolved not in one hit but gradually adding complexity over a long period of time. There is one huge problem with that explanation and that is we are talking about replication systems. An important part of the theory of evolution is that there is a chain of descent between parents and their offspring.&lt;br /&gt;To inherit genes from you parents, those genes must be copied (or replicated).  For Darwin to be right you need a fully automatic information replication system in place and it has to be there right from the start and it would need to do its copying to be reasonably accurate to avoid something called ‘error catastrophe’,  (‘error catastrophe’ would cause a replicating cell to be overloaded by too many mutations, the result would be certain extinction). Looking at this from the point of view of someone who has a ‘hands on’ feel for some of the design issues involved in a comparatively simple automated replication system, I’d have to say there is no way the first living cell could be a lucky accident. As far as I’m concerned all bets are off. &lt;br /&gt;Now while some materialistic naturalists would say that I am completely ignoring the possibility that the first self-replicating life could have been much simpler, my response would be ‘prove it’. While crystals are not complex and they can replicate their own structure, they can’t replicate what William Dembski calls ‘complex specified information’.&lt;br /&gt;The simplest living cell that can live independent of a host is many times more complex than crystals and it can replicate complex specified information because it’s replication system uses DNA.&lt;br /&gt;My article obviously cannot cover all the aspects of that topic so I urge interested readers to check out this &lt;a href="http://www.creationontheweb.com/content/view/3028/"&gt;FAQ page&lt;/a&gt; on the subject of the origin of life.&lt;br /&gt;&lt;br /&gt;&lt;span style="font-weight:bold;"&gt;How would they respond?&lt;/span&gt;&lt;br /&gt;So how would qualified biologists (at least one that accepts the theory of evolution) respond to this article? Well first of all they would seek to undermine my authority to talk on this issue. My “hands on” experience of co-designing and maintaining replication systems would count for little in their view. Well my response to that is that there are some very qualified scientists who believe that an Intelligent Designer agent is a best explanation for the complexity that we see in living things. The list includes &lt;a href="http://www.trueorigin.org/behe08.asp"&gt;Michael Behe&lt;/a&gt; (microbiologist), William Dembski (Mathematics), &lt;a href="http://www.creationontheweb.com/content/view/3499/"&gt;Dr Don Batten&lt;/a&gt; (Agriculture) and many more. So by all means don’t take my word for it, please check out what these people have to say. Another response that an evolutionist would likely put forward is (to roughly paraphrase Richard Dawkins) that the argument from personal incredulity (extreme feeling of scepticism) is not scientific proof; just because something does not seem likely does not prove that it can’t happen. My response is, it does not prove that it can happen either. In fact the more I learn about replication and biology, the more incredulous I become. My personal incredulity increases as I learn more about this topic. They are yet to prove that a self-replicating system that contains complex specified information can arise by chance. For materialists to say that they are yet to find out how it happened and that it will just take more research is special pleading, they have just assumed that God is not the explanation and ruled Him out right at the start, they accuse Creationists of giving up on science yet they ignore the fact that they have done exactly the same thing by giving up on God. To say that there must be some as yet discovered explanation just demonstrates great faith in naturalism, trivialises the complexity of microbiology and ignores the difficulty in resolving design issues that are encountered in the replication of information. Some materialist would mention the time span and suggest that evolution has billions of years to do what takes engineers months. I’m incredulous about a cow jumping over the moon, I don’t care how many hypothetical cows you have on whatever hypothetical number of planets, it is not going to happen in the longest estimates for the age of the Universe, I’m convinced that a naturalistic origin of a self replicating cell has a similar level of improbability.&lt;br /&gt;It is scientific to look at the scene of the crime and determine that it was not an accident and that an individual who had the capacity to think is responsible for what happened. In the same way William Dembski and &lt;a href="http://www.creationontheweb.com/content/view/1533"&gt;Werner Gitt&lt;/a&gt; have both shown that where complex information is present then ultimately an intelligent agent is responsible for it’s existence. &lt;br /&gt;What I have learned through my ‘hands on’ work with automated replication systems only backs up what some very qualified people have been saying all along.&lt;br /&gt;&lt;a href="http://www.creationontheweb.com/content/view/3492/"&gt;Alex Williams&lt;/a&gt; has written several articles about the complexity of DNA and there are links to those articles from the link that I given. If you have any interest in IT or engineering then I urge you to learn about the complexity of the design in living cells and while you do, imagine how difficult it would be to engineer a computer system that works like that. &lt;br /&gt;&lt;br /&gt;&lt;span style="font-weight:bold;"&gt;Conclusion&lt;/span&gt;&lt;br /&gt;Every time I read something new about DNA or the complexity of a living cell, it just seems to get all the more complex and much more unlikely that it could have started by chance. &lt;br /&gt;So when I read books like Michael Behe’s book “Darwin’s Black Box” or various articles on &lt;a href="http://www.creationontheweb.com/"&gt;CMI’s website&lt;/a&gt; or watch videos like &lt;a href="https://store.creationontheweb.com/us/product_info.php?products_id=434&amp;osCsid=62b09342eaa3330e72fc197a33bb333e"&gt;Unlocking the Mystery of Life DVD&lt;/a&gt;, I find myself having an extremely high degree of “personal incredulity” that life originated by natural processes without the aid of an Intelligent Designer.&lt;br /&gt;I seriously doubt that they will ever find a solid naturalistic explanation for life’s origin, they have had many guesses and some of those guesses were based on elaborate experiments (designed and operated by intelligent chemists) but even so, a guess is not a proof. As far as I’m concerned they never will be able to prove scientifically that an automated self-replicating life form came about by chance, my hands-on experience with automated self-replicating data systems has raised my level of ‘personal incredulity’ to a level that puts the idea of that well and truly off the radar as far as I’m concerned. &lt;br /&gt;Let me say that again in plainer language, my work in information technology has made me very sceptical that something many times more complicated could happen as a result of a lucky accident.&lt;br /&gt;As far as I’m concerned life is the result of an Intelligent Designer and as far as I’m concerned the best candidate for that role is revealed in the person of Jesus. See &lt;a href="http://leestrobel.com/"&gt;Lee Strobel's&lt;/a&gt; website for online videos that present the evidence that Jesus was a real person and that He is our God and Creator.&lt;br /&gt;Please follow this link if you would like to know &lt;a href="http://leslieey.com/gospel.html"&gt;how to become a Christian &lt;/a&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1479329177592025809-8811911763639492454?l=les-ey.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://les-ey.blogspot.com/feeds/8811911763639492454/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=1479329177592025809&amp;postID=8811911763639492454' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1479329177592025809/posts/default/8811911763639492454'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1479329177592025809/posts/default/8811911763639492454'/><link rel='alternate' type='text/html' href='http://les-ey.blogspot.com/2008/01/complicated-data-copying-systems.html' title='Complicated Data Copying Systems: A Problem for Evolution'/><author><name>Les</name><uri>http://www.blogger.com/profile/05561653336505981873</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1479329177592025809.post-2982702798298322495</id><published>2007-05-24T20:10:00.000-07:00</published><updated>2008-11-13T00:32:52.717-08:00</updated><title type='text'>Were the Apollo Moon Landings Hoaxed?</title><content type='html'>In this article, I would like to show why I believe that the moon landings were not hoaxed. It is my intention to present this article with a low-pressure attitude. I have a personal interest in space and astronomy and that is the main reason that I wrote it. There are far more important issues and I accept that there will be people who will not be convinced by my reasoning. If you feel strongly that the moon landings were a hoax and are not convinced by this article then can I please ask that we disagree without being disagreeable?&lt;br /&gt;&lt;br /&gt;I’m a &lt;a href="http://www.creationontheweb.com/"&gt;Creationist&lt;/a&gt; and I believe that the Bible is accurate and that it can be trusted.&lt;br /&gt;&lt;br /&gt;I believe that because I see the Bible as work of eyewitnesses and as &lt;a href="http://www.leestrobel.com/"&gt;Lee Strobel &lt;/a&gt;points out in his book “The Case for Christ”, there is other evidence to corroborate it as well. (Lee Strobel has videos of interviews related to the topics of his books. The videos can be viewed for free on his &lt;a href="http://www.leestrobel.com/"&gt;website&lt;/a&gt;). Lee Strobel investigated the life; death and resurrection of Jesus based on the eyewitness accounts and weighed up the evidenced as if it was a court case.&lt;br /&gt;So I want to apply a similar approach as Lee Strobel and see if it is reasonable evidence that the moon landing occurred.&lt;br /&gt;For my research I have used and recommend the following materials.&lt;br /&gt;&lt;br /&gt;Space Race - Deborah Cadbury&lt;br /&gt;Failure is not an option - Gene Kranz&lt;br /&gt;The Two Sides of the Moon - David Scott and Alexi Leonov&lt;br /&gt;Apollo Thirteen (formerly titled “Lost Moon”) - Jim Lovell&lt;br /&gt;Soul Obsession - Nicky Cruz&lt;br /&gt;&lt;br /&gt;Let’s take a look at the eyewitness accounts, at NASA’s supposed motive to hoax the landings (and see if it is still valid after all these years) and some of the evidence (both for and against). Your job is to sit on the jury and make up your own mind.&lt;br /&gt;&lt;br /&gt;The witnesses&lt;br /&gt;&lt;br /&gt;There were many witnesses who were involved in the Apollo program. There were the astronauts themselves, there were the flight controllers, the engineers, the contractors, the radio operators (who talked to or heard the astronauts), the naval personnel (who retrieved the astronauts from their capsules) and many others besides.&lt;br /&gt;There were seven missions that were sent out with the intention of landing on the moon. One of the missions failed (Apollo 13), the book “Apollo 13” (formally titled “Lost Moon”) was written by Jim Lovell and in the book Jim talks about his life as a test pilot, his application for the space program and the 4 space missions that he flew. The movie “Apollo 13” is based on the failed Apollo mission that Jim was the commander of. The special edition DVD features documentaries as well as a commentary by Jim Lovell and his wife, which is interesting for what you can learn about the Apollo program. Ron Howard also has a commentary that is interesting because it portrays how difficult it was to film scenes where the action is supposed to take place in zero gravity. Howard actually used a special jet that NASA uses to train astronauts. The jet reaches high altitude and then deliberately dives toward the ground. The jet and the people onboard are effectively in freefall but experience the same sense of weightlessness that someone in orbit around the Earth would. Howard was only able to film in short burst of less than thirty seconds. (Except in the studio where the zero-g effect was mimed).&lt;br /&gt;There were seven attempted moon-landing missions and six successful ones. If you count the other two missions (Apollo 8 and 10) that only orbited the moon then there were supposedly 9 NASA missions that were faked, (that is if man never went to the moon), there were 24 astronauts who flew on these missions, (there were 3 astronauts on each mission but some astronauts flew on more than one Apollo mission).&lt;br /&gt;Why would someone think it was a good idea to fake between 7 and 10 missions? Why fake the landing more than once? Wouldn’t that be asking for trouble? It would be hard enough to fake the landing once let alone six times. If Apollo 13 was a hoax and the lives of the crew were never really in danger then why draw the attention of the entire world to the mission? Why would NASA cooperate with not only with the makers of the movie “Apollo 13” but also with “Capricorn 1” (the movie about a hoaxed Mars landing that portrays NASA as the bad guys)? Is it unreasonable to conclude that NASA cooperated in the making of both of those movies because they had nothing to hide?&lt;br /&gt;&lt;br /&gt;Jim Irwin&lt;br /&gt;&lt;br /&gt;Jim Irwin (Apollo 15) has publicly promoted his Christian beliefs. In his books, Jim Irwin professes faith in Jesus and actively endorses the accuracy of the Bible. Nicky Cruz is a former New York gang leader who was lead to the Lord by David Wilkerson (this was written about in David Wilkerson’s book “The Cross and the Switch Blade”). In his own book “Soul Obsession”, Nicky says, “Jim was one of my dearest friends, a true brother in the Lord …”. The chapter titled “From the Moon to the Ghetto” talks about the influence that Jim had on Nicky’s life. The Moon landing is presented as a fact throughout the chapter without the slightest hint that something sinister might have happened. Nicky makes it clear that he was a close friend of Jim and that they spent a lot of time together and they even went mountain climbing together.&lt;br /&gt;Is Nicky Cruz part of the NASA conspiracy?&lt;br /&gt;I personally accept Jim Irwin’s eyewitness account of his own moon landing and Nicky Cruz’s endorsement of his character as being good evidence that the Moon landings occurred.&lt;br /&gt;&lt;br /&gt;The Dish&lt;br /&gt;&lt;br /&gt;There is an Australian movie called “The Dish” that has come out about the Apollo 11 mission from the point of view of an Australian tracking station called Parkes. Parkes has a large Satellite dish that was used to communicate with the Apollo missions. Parkes was one of the tracking stations used when the Moon was on the wrong side of the Earth for America to communicate directly with the Apollo spacecraft. “The Dish” is based on real events but the characters in the movie are fictional and some of the events (such as the reception of the live television signals of Armstrong’s first step) happened at another Australian tracking station. The movie has a scene where the power goes down at Parkes, the emergency generator was not running and so the computer shut down and in those days that meant that they lost all their data (including the location of the spacecraft). You see the crew of the tracking station trying frantically to calculate where the spacecraft should be in order for them to regain contact with the spacecraft. In the end someone comes up with the idea to point the dish at the Moon and so they tried that and the result was that communication was restored. The blackout probably never took place but that highlights a question that I would like to ask. Wouldn’t it seem reasonable that the staff of Parkes would know if their Dish was pointed at the Moon or not? If the astronauts were really in some kind of movie studio then how did the guys at Parkes receive a transmission that seemed to be coming from the direction of the Moon? Are the staff members from Parkes in on NASA’s conspiracy? Perhaps NASA somehow managed to transmit the signal to the spacecraft, which in turn transmitted the signal right back again. The problem with that is that there would be a delay in response that was twice the length that it should be at any given time. Huston would have been on the wrong side of the Earth half the time, so they would have to relay the signals to transmitters on the other side of the globe and hope the links stay online. Not only that but there would still have to be spacecrafts in the right position anyway (one in Luna orbit and one on the Moon’s surface). Why would they send an empty spacecraft if they had the technology and could reach the Moon? If there was a problem with life support (as in the movie Capricorn 1) then what was that problem and why wasn’t it solved before Apollo 17?&lt;br /&gt;&lt;br /&gt;The Motive&lt;br /&gt;&lt;br /&gt;Let’s take a look at why NASA might be motivated to fake the Moon landings. The Apollo missions took place back in the late 60’s and early 70’s. That was during the height of the cold war, the Cuban missile crisis and the “Bay of Pigs” was fresh in people’s minds. The Soviet Union had performed a string of firsts, including the first satellite and first man in space. There was a great fear that the Soviets would control space and be able to win a nuclear war because of their advanced rockets and technology. The US was keen to beat the Russians at something and a manned Moon landing was their best hope. So if the Americans were struggling to win that race there would have been a huge incentive to fake the Moon landing to save embarrassment.&lt;br /&gt;One huge problem with that idea is that NASA is not very good at covering up embarrassing facts from the ever-watching media, if you don’t believe me then read the book, “Failure is not an option” by Gene Kranz, or just keep an eye out for news about NASA on TV. If NASA had really faked the moon landing then why hasn’t NASA admitted it before now since every embarrassing moment of the Apollo program is now public knowledge? Many facts that NASA would find embarrassing can be read about in books like “Space Race” by non-partial authors like Deborah Cadbury of the BBC. (Unless the BBC is part of the cover-up!) Another problem with the “saving embarrassment” motive is that according to Neil Armstrong it was easier to fly the mission than it would have been to fake it (see the book “First man”). The cold war is over; the Cuban missile crisis is a faint memory, NASA no longer has a motive to hide any supposed hoax so why don’t they just come out and admit the hoax if there really was one? What about all the Apollo astronauts themselves? They no longer have their whole lives ahead of them, why hasn’t even one of them approached the scandal hungry media? (Is the media in on NASA’s cover-up as well?) Here is the ultimate problem with that motive; if NASA had the means to get to the Moon then they had an even bigger motive to go there than they did to fake it. The “saving embarrassment” motive only works if NASA could not get there and I’m yet to see any detailed hard evidence that they could not.&lt;br /&gt;&lt;br /&gt;The Hostile Witnesses&lt;br /&gt;&lt;br /&gt;If anyone would have a motive to expose a NASA cover up it would have been the Soviet Union. The Soviets had many secrets of their own. They kept the deaths of a few cosmonauts quiet for many years to save their own embarrassment.&lt;br /&gt;The book “Space Race” tells the history of the Space program from the time that the Soviets and the Americans were racing each other to capture the German rockets and scientists up to the successful Moon landing. You get to read about the main disasters and embarrassments for both sides not just the high points. The Soviets would have loved to be able to expose the Americans if the moon landing was faked. It seems obvious to me that the Soviets would have monitored the entire US space program to the best of their ability and if there was the slightest hint that something was not right they would have loved to let the entire world know about it. That is unless the Soviet Union was in on the conspiracy. But that would not make sense, would it? Why would the Soviet Union conspire with the Americans to save the Americans from embarrassment? How is it that we can learn about the embarrassments that the Soviets had and yet somehow NASA has managed to keep their own embarrassment secret?&lt;br /&gt;&lt;br /&gt;The evidence for - Video, Audio and Photographic Evidence&lt;br /&gt;&lt;br /&gt;There are hundreds of Videos, pictures and audio files available for download from the NASA website. One item of special note is the Hammer and Feather video clip. David Scott was the commander of Apollo 15, the mission that Jim Irwin went on. Shortly before the leaving the surface of the Moon, David Scott held up a hammer and a feather at roughly the same height (The hammer head was a little lower than the feather). Scott dropped the hammer and the feather at the same time and the hammer hit the ground only a fraction of a second before the feather. But what impressed me the most about the experiment was the way that the feather flew, the feather did not float or swish from side to side but went straight down and bounced about three times. The video is a little blurry and the feather looks very blurry but if you watch the video carefully you can see that the object appears to be lightweight and flimsy (going by the way it flexes about in Scott’s glove). You see the full paths of the feather and hammer from Scott’s hands to the ground. (That was something that Tom Hanks did not attempt to reproduce in the HBO series “From the Earth to the Moon” – The scene is cut, you see the hammer and feather start dropping then it cuts to them hitting the ground). There are also other videos of astronauts experiencing weightless/low gravity conditions. While it might be conceivable that such footage could be faked in a film studio (even back in the early 70s) it is difficult to accept that they could have done this in real time since special effect movies take a long time to make and they would have had to make many hours of simulated low gravity/zero gravity videos.&lt;br /&gt;&lt;br /&gt;The Physical Evidence&lt;br /&gt;&lt;br /&gt;There is positive evidence that they did land on the Moon. The astronauts brought back rocks from the Moon. The rocks are held in Museums right around the world. Geologists from around the world have examined the rocks. Moon rocks are different from Earth rocks. Admittedly it takes geologists to tell them apart from Earth rocks but the rocks show clear signs of being formed in conditions that were free of liquid water as well as oxygen and they also contain marks from micro meteors.&lt;br /&gt;Are all the geologists that have viewed the rocks part of NASA’s cover-up as well? Not only do we have solid evidence on Earth but there is solid evidence that can be detected on the Moon as well. The Moon is moving away from the Earth at the tiny amount of nearly 4cm per year. To be able to measure that distance to that kind of accuracy lasers are used. The lasers are pointed at four mirrors that were left behind by four different Luna missions. Scientists would not make up a story about the Moon receding from the Earth at a rate of 4cm/year because that was not what the scientists believed before the distance could be accurately measured. Scientists believed that the Moon was in a stable orbit. See the DVD from the BBC called “The Sun/The Moon”. Are the people who operate those lasers in on the conspiracy?&lt;br /&gt;&lt;br /&gt;The Evidence of Fraud&lt;br /&gt;&lt;br /&gt;So what evidence is put forward to prove that the moon landings were a hoax? There is no real evidence that NASA could not put a man on the Moon. The evidence that is put forward is based people’s unfamiliarity with what it would be like to be on the Moon and a dose of suspicion as well as the power of suggestion that comes by watching movies like Capricorn 1.&lt;br /&gt;There are a number of &lt;a href="http://science.nasa.gov/headlines/y2001/ast23feb_2.htm"&gt;websites including NASA’s&lt;/a&gt; own that refute the supposed evidence of the alleged hoax and I don’t want to cover too much old ground but as an amateur photographer I would like to address few of these points.&lt;br /&gt;&lt;br /&gt;1. Stars do not appear in the black sky of the pictures taken on the Luna surface.&lt;br /&gt;&lt;br /&gt;NASA can supposedly do a great job of simulating every aspect of the Luna missions but someone forgot to paint the stars on the studio set. Out of all the people involved in the production, no one thought about the stars! Well here is an experiment you can try by yourself. Get out your camera go outside on a very bight day and make a note of the exposure settings that your camera would use for that exposure. This would be close to the right exposure setting for the highly reflective surface of the Moon during the Luna day. (Luna daytime lasts for nearly 15 Earth days and the astronauts were never on the surface during the Luna night) Set your camera to manual and use the same exposure settings that would have been used for bright sunlight. Now go outside on a clear moonless night point your camera at the stars (you could even try the planet Venus if you like) and take your photo. How many stars can you see in your picture? My guess is very few but most likely none if you did the experiment right.&lt;br /&gt;&lt;p&gt;&lt;br /&gt;&lt;a href="http://3.bp.blogspot.com/_6_WygSufJKE/RlkMC3akzXI/AAAAAAAAAAc/N6PGT3Y9ZvM/s1600-h/southern-cross.jpg"&gt;&lt;img id="BLOGGER_PHOTO_ID_5069096098956889458" style="DISPLAY: block; MARGIN: 0px auto 10px; CURSOR: hand; TEXT-ALIGN: center" alt="" src="http://3.bp.blogspot.com/_6_WygSufJKE/RlkMC3akzXI/AAAAAAAAAAc/N6PGT3Y9ZvM/s320/southern-cross.jpg" border="0" /&gt;&lt;/a&gt;&lt;br /&gt;Photo of "Crux" (The Southern Cross) 4 second exposure&lt;br /&gt;&lt;/p&gt;&lt;br /&gt;&lt;br /&gt;&lt;a href="http://1.bp.blogspot.com/_6_WygSufJKE/RlkO-XakzaI/AAAAAAAAAA0/qm5ZApyGi5g/s1600-h/1_180th.jpg"&gt;&lt;img style="display:block; margin:0px auto 10px; text-align:center;cursor:pointer; cursor:hand;" src="http://1.bp.blogspot.com/_6_WygSufJKE/RlkO-XakzaI/AAAAAAAAAA0/qm5ZApyGi5g/s320/1_180th.jpg" border="0" alt=""id="BLOGGER_PHOTO_ID_5069099320182361506" /&gt;&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;Same area of the sky 1/180th second exposure&lt;br /&gt;&lt;br /&gt;2. The cross hairs on the pictures appear to be faked because they seem to appear behind the objects that are being photographed.&lt;br /&gt;&lt;br /&gt;&lt;br /&gt;Here is a second experiment you can do yourself. Get out your camera on a night where the moon is visible (A quarter Moon will do).&lt;br /&gt;Place your camera on a tripod and position your camera so that a thin object like a telephone line or a thin tree branch is in front of the moon. Take a photograph with a reasonably long exposure say 1 or 2 seconds. If your photograph turns out the way I would expect then the wire will appear to be behind the Moon. Is that evidence that you did not take the photograph yourself but faked it?&lt;br /&gt;&lt;a href="http://4.bp.blogspot.com/_6_WygSufJKE/RlkMTHakzZI/AAAAAAAAAAs/EL6rHxCp-Go/s1600-h/tree-overexposed-moon.jpg"&gt;&lt;img id="BLOGGER_PHOTO_ID_5069096378129763730" style="DISPLAY: block; MARGIN: 0px auto 10px; CURSOR: hand; TEXT-ALIGN: center" alt="" src="http://4.bp.blogspot.com/_6_WygSufJKE/RlkMTHakzZI/AAAAAAAAAAs/EL6rHxCp-Go/s320/tree-overexposed-moon.jpg" border="0" /&gt;&lt;/a&gt;&lt;br /&gt;The moon "eats" into a tree branch when using a long exposure&lt;br /&gt;&lt;br /&gt;&lt;a href="http://2.bp.blogspot.com/_6_WygSufJKE/RlkMNnakzYI/AAAAAAAAAAk/pNfoO1qInvI/s1600-h/tree-moon-flash.jpg"&gt;&lt;img id="BLOGGER_PHOTO_ID_5069096283640483202" style="DISPLAY: block; MARGIN: 0px auto 10px; CURSOR: hand; TEXT-ALIGN: center" alt="" src="http://2.bp.blogspot.com/_6_WygSufJKE/RlkMNnakzYI/AAAAAAAAAAk/pNfoO1qInvI/s320/tree-moon-flash.jpg" border="0" /&gt;&lt;/a&gt;&lt;br /&gt;Taken with the camera in the same position but using a flash&lt;br /&gt;&lt;br /&gt;3. The shadows point in the wrong direction.&lt;br /&gt;&lt;br /&gt;Here is another experiment you can try. Get out your camera again and take pictures of upright poles that are spaced at regular intervals over a wide area. Use different lens settings - try using a wide-angle lens (35mm or less). Photograph the poles from various angles and distances and see whether you can get the shadows to look normal in every shot.&lt;br /&gt;Now try taking a 360 panorama of the scene and joining the pictures together to make one picture. Does the result look weird or not?&lt;br /&gt;&lt;br /&gt;4. The photographs are too good/too bad&lt;br /&gt;&lt;br /&gt;This is a no win situation because the video and pictures of the Luna landing have been criticized for being both too poor a quality as well as too professional. As an amateur photographer I find that on the same day I can still manage to take some very poor quality shots but if I take enough shots one or two might turn out good enough to seem of reasonable standard to most people (except professionals). The astronauts were trained to use the cameras just like every other piece of equipment that they were required to use and on some occasions they got it right and on other occasions they made mistakes. Also it should be noted that there was more than one Luna mission and the quality of the cameras increased as new technology became available. From Apollo 15 through to 17 there were video cameras on the “Moon buggies” that were operated by remote control from Earth. It is also worth noting that video cameras did not have the same quality as the Haselblads that were used to take still photos.&lt;br /&gt;&lt;br /&gt;Make your own conclusion&lt;br /&gt;&lt;br /&gt;The disadvantage of examining something that happened in the past is that you can never be 100% certain if you were not there and did not see it for yourself. Having examined the evidenced for both the Moon landings and the life of Jesus Christ, I’m personally convinced that Neal Armstrong walked on the Moon and that Jesus is a real person who died and rose again. The difference being that Jesus is still changing people’s lives today and that is something that you can &lt;a href="http://www.leslieey.com/gospel.html"&gt;experience for yourself.&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;I don’t think that many people doubt that Sir Edmund Hillary made it to the top of Mount Everest or that Scott reached the South Pole but for some reason people doubt that Armstrong set foot on the Moon in spite of there being much more evidence that he did.&lt;br /&gt;I have left out a number of other points put that are put forward by the people who claim that the landings were all hoaxed. These points are based mainly on the assumptions of people who have a limited understanding about Physics and what it is really like on the Moon.&lt;br /&gt;Common sense is a disadvantage when it comes to making up your mind whether a photograph or video that was taken on the Moon is real or not. Suspicion and suggestion will only make matters worse.&lt;br /&gt;&lt;br /&gt;I could add more to this article if I wanted to but I think I’ve said enough. A search of the Internet will give you more articles both for and against. Anyway there are more important issues to ponder than the Moon landing so I’ll leave it at that and let you make up your own mind.&lt;br /&gt;&lt;br /&gt;I'll finish with a quote from Gene Cernan of Apollo 10 and 17; it comes from the ending credits of the documentary, "In the shadow of the Moon"&lt;br /&gt;&lt;br /&gt;Truth needs no defense.&lt;br /&gt;&lt;br /&gt;Nobody, Nobody can ever take those footsteps that I made on the surface of the Moon away from me.&lt;br /&gt;&lt;br /&gt;&lt;p&gt;&lt;/p&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1479329177592025809-2982702798298322495?l=les-ey.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://les-ey.blogspot.com/feeds/2982702798298322495/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=1479329177592025809&amp;postID=2982702798298322495' title='2 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1479329177592025809/posts/default/2982702798298322495'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1479329177592025809/posts/default/2982702798298322495'/><link rel='alternate' type='text/html' href='http://les-ey.blogspot.com/2007/05/were-apollo-moon-landings-hoaxed.html' title='Were the Apollo Moon Landings Hoaxed?'/><author><name>Les</name><uri>http://www.blogger.com/profile/05561653336505981873</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><media:thumbnail xmlns:media='http://search.yahoo.com/mrss/' url='http://3.bp.blogspot.com/_6_WygSufJKE/RlkMC3akzXI/AAAAAAAAAAc/N6PGT3Y9ZvM/s72-c/southern-cross.jpg' height='72' width='72'/><thr:total>2</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1479329177592025809.post-716746471859132102</id><published>2007-05-24T19:44:00.000-07:00</published><updated>2007-05-24T20:09:35.506-07:00</updated><title type='text'></title><content type='html'>&lt;h3&gt;Does Evolution Need a Few Intelligent Designers?&lt;/h3&gt;This article is longer  and more technical than most of my other articles but I hope that it will answer  questions that people might have about so called “evolution” on computers  (hopefully I will do so using reasonably simple language).&lt;br /&gt;In this article I  will be looking at genetic algorithms. A genetic algorithm is a type of computer  program that is supposed to simulate evolution. The concept of generating new  information is a key concept in this article, so I recommend that you read my  introductory article on the &lt;a href="http://www.leslieey.com/origin-of-information.html"&gt;origin of genetic  information&lt;/a&gt; if you are unfamiliar with the concept. Throughout this article  I will refer to open-ended evolution, so I will briefly explain what I mean by  the term. Open-ended evolution would be evolution that could keep on evolving  without hitting a brick wall (It should keep on generating new complexity  indefinitely). If open-ended evolution could occur on a computer, it would not  only be able to produce a wide range of “species” but it should also produce  some very complicated designs (all without being given any hints of what those  designs are like and without being aided by any hidden function). For an amoeba  to evolve into a man you would need a considerable amount of open-ended  evolution.&lt;br /&gt;&lt;h4&gt;Designer evolution&lt;/h4&gt;Rodney Brooks is one of the world leaders in robotics  and artificial intelligence and he is adamant that evolution is the only  reasonable explanation for how we came to exist. In his book, Flesh and  Machines: How Robots Will Change Us, Brooks said, “I think we probably need a  few Einsteins or Edisons to figure out a few things that we do not yet  understand.”&lt;br /&gt;Both Einstein and Edison were very intelligent. So what is it  that Brooks was referring to when he said that? Well it turns out that Brooks  was talking about the problems of designing computer software in two related  fields. One field was “open-ended” genetic algorithms and the other field was  software that can think, reason and feel emotion like us (this is known as  strong artificial intelligence). &lt;br /&gt;In effect Brooks was saying that it would  probably take a few (very) intelligent designers to figure out why open-ended  evolution and human like intelligence is not yet seen on computers.&lt;br /&gt;In this  article I will mainly focus on the concept of “open-ended” evolution and look at  why an ardent evolutionist would say something like that and what I feel the  implications of that statement are for the theory of evolution.&lt;br /&gt;&lt;h4&gt;Are we special?&lt;/h4&gt;To understand why the remark that Brooks made is a  problem for evolutionists we need to understand Brooks’ point of view. In his  book, Brooks has one chapter titled “We are special” which is followed  immediately by another titled “We are not special”. That is a deliberate  contradiction that Brooks is using to convey a paradox (the paradox exists in  the way he thinks about human beings). He points out a lot of unique and  remarkable things about us, but then he also puts forwards a view of people as  nothing more than chemical machines that were designed by evolution (as far as  Brooks is concerned).&lt;br /&gt;Materialists believe that matter is all there is, that  there is nothing outside of what we can see (so to speak) and so they believe  that there is no spiritual realm and that we do not have a spirit that can live  on after our physical brain is dead. Brooks believes that our mind, will,  emotions, conscious awareness and intuition are only the result of neurons  firing in our brain and nothing more. If however, we were just machines that  were made by evolution then it would seem that it should be possible for us to  make machines that are at least as intelligent as us. However, Brooks points out  that there may be a limitation to our intelligence that prevents us from  understanding our own intelligence enough to make something as intelligent as  ourselves. But even if we don’t understand our own intelligence sufficiently -  if evolution is as powerful as it is often portrayed - what would stop it  evolving on a computer if we allowed it to do so?&lt;br /&gt;&lt;h4&gt;Who wants to be a Billionaire?&lt;/h4&gt;Imagine if your computer had a system on  it that could write complicated computer programs. Imagine if you were the  person who engineered that system? (Or more importantly, what if you owned the  royalties to it?) You could be rich, very rich! You would not have to employ  people, you could just buy a few computers and let them do all the work and you  would not have to pay them anything. If you were as good an entrepreneur as Bill  Gates then no other software house could compete with you. So why hasn’t anyone  tried this? All they would have to do is to write a computer program that could  write programs of its own by either being able to think for itself or by helping  other programs to evolve on computers by themselves. Well genetic algorithms are  supposed to imitate evolution so lets take a look at genetic algorithms.&lt;br /&gt;&lt;h4&gt;What is a Genetic Algorithm?&lt;/h4&gt;“Genetic algorithm” (GA) is another name  for artificial life (ALife is an abbreviation for artificial life). For the  purpose of this article I will use the terms Genetic algorithm (GA) and  artificial life (ALife) interchangeably. I will avoid talking about scientific  definitions of life because for this article my main concern is how information  is generated and not how scientists define life.&lt;br /&gt;An algorithm can be thought  of as a sequence of logical steps or tasks that a mathematician or a computer  program performs in order to solve a problem or perform a task. A genetic  algorithm is a special type of algorithm that is written to solve problems using  steps that are designed to act the way that evolution is supposed to. So a  genetic algorithm is a computer program that is designed to solve problems in a  way that is supposed to simulate evolution. The kinds of problems that can be  solved by genetic algorithms include problems like designing efficient aircraft  wings and other trial and error type problems. The program will have a  population and the population will consist of a number of “solutions” or  “virtual life forms” that “spawn” (or if you like give birth to) their own  “offspring”. At each generation something a little different is tried and then  the best solution is chosen  (or the best of a limited number of solutions are  chosen). All the other solutions die out or technically speaking, they are  deleted. The solutions that are chosen spawn children of their own. This is  repeated until the genetic algorithm finds a solution that works as it is  required to.&lt;br /&gt;I should emphasize the point right now that genetic algorithms  do work, they do amazing things and some of those things - I wish I did not have  to admit - made me feel somewhat uneasy until I thought through the real  implications of what they actually did.&lt;br /&gt;But in his book Darwin’s Black Box,  Michael Behe puts it this way&lt;br /&gt;‘You can get pretty pictures and nice games on  the computer, but even most Darwinians recognize that these simplistic models  are a long way from the real, complex world of biology and chemistry.’&lt;br /&gt;Even  though genetic algorithms can design the shape of aircraft wings and other  things that would require an engineer to do a lot of trial an error type work,  they don’t go anywhere near achieving the range or level of complexity that  evolution is supposed to have done. I like to think of genetic algorithms as  “guessing game” or “the price is right” programs. All you do is design the  program so that it can calculate if something is “hot” or “cold” and let it keep  trying something else until it zeros in on the answer. That’s fine for guessing  games, computers can “optimise” by trial and error much faster than humans can  but human engineers are much better at solving most problems than genetic  algorithms are.&lt;br /&gt;But, if genetic algorithms can do some of the work of a  designer, doesn’t that prove evolution at least in part? Later in the article I  will talk about the concept of “new information” and show that genetic  algorithms don’t produce new information. Genetic algorithms use something  called a “fitness function” to borrow information from the genetic algorithm  itself. So that leads to the question, “What is a fitness function?”&lt;br /&gt;&lt;h4&gt;What is a fitness function?&lt;/h4&gt;The concept of a fitness function is a  technical concept but it is important to understand it because this is where  information is hidden and, as I will show later, the problem of where the  information actually comes from is a key part in answering the question of  whether genetic algorithms support evolution or in fact help to question it. &lt;br /&gt;So what is a fitness function? A fitness function is a module (a part of a  computer program) that is used to play the role that natural selection is  supposed to play in real life. The fitness function does the choosing so it  decides which virtual life forms live to reproduce and which ones do not. (In  most genetic algorithms it is the genetic algorithm that does the actual  copying). In The Blind Watchmaker, Richard Dawkins describes a program that he  wrote that he refers to as the monkey/Shakespeare model. He wrote the program to  illustrate the concept of “cumulative selection”. He starts off by talking about  “single step” selection. To explain single step selection, Dawkins looked at the  chance that a monkey would have of typing a phrase on a specially designed  typewriter that only has capital letters and a space bar.  He chose the phrase,  “METHINKS IT IS LIKE A WEASEL”, which comes from the Shakespearean play called  Hamlet.&lt;br /&gt;He calculated that the chance of a monkey matching the exact phrase  in one go would be about 1/10&lt;sup&gt;&lt;small&gt;40&lt;/small&gt;&lt;/sup&gt;. Well what if you  could let the monkey keep right on typing until he matched Shakespeare’s phrase?  In the book, No Free Lunch, Dembski states that to have a better than even  chance the monkey would need 10&lt;small&gt;&lt;sup&gt;40&lt;/sup&gt;&lt;/small&gt; tries. Dawkins  concluded, “To put it mildly, the phrase we seek would be a long time in coming,  to say nothing of the complete works of Shakespeare.” Well let’s not put it so  mildly, just how long would it take a monkey to type that reasonably short  phrase? For a monkey to type 10&lt;sup&gt;&lt;small&gt;40&lt;/small&gt;&lt;/sup&gt; letters if it could  type right around the clock at a rate of ten letters per second (with an  unlimited supply of recycled paper) it would take about 3 x  10&lt;sup&gt;&lt;small&gt;32&lt;/small&gt;&lt;/sup&gt; years, that is a 3 with 32 zeros following it.  You could knock off 9 zeros of you had a billion monkeys to do your typing but  that is still many times longer than evolutionists claim that the Universe has  existed for.&lt;br /&gt;That would be using single step selection but what is  cumulative selection? That is where you might start with something random and  change it a little each time and keep the changes that you like and discard the  changes that you don’t like. So cumulative selection gradually builds up good  changes. Dawkins shows quite clearly that it is extremely unlikely that  haemoglobin can be generated by single step selection. He estimates that the  chance making just one out of the 4 “chains” that make haemoglobin in one  attempt would be about 1 in 10&lt;sup&gt;&lt;small&gt;190&lt;/small&gt;&lt;/sup&gt;. That is an  unimaginably smaller chance than the monkey had of typing Shakespeare’s phrase.  It is worth noting here that a “simple” living organism is much more complicated  than haemoglobin alone because it contains many times that amount of complexity.  Scientist are yet to show how something could survive that is a lot less  complicated than the simplest living organism that we know about today. Only  “living” things can reproduce and you need reproduction for cumulative selection  to work so the first living thing must have come about by single step selection  (if you don’t want to accept that God created life). So for life to come into  existence without God’s help would require something far more unlikely to happen  than a monkey typing “METHINKS IT IS LIKE A WEASEL” by chance alone.  Evolutionists try to avoid the origin of the first living cell by suggesting  that there was a molecule that could make copies of itself that gradually  evolved into a cell but they do not agree on what that molecule was and they  don’t know how it came about. In the preface of his book titled The Origin of  Life Paul Davies wrote&lt;br /&gt;&lt;div style="margin-left: 40px;"&gt;Many investigators feel uneasy about stating in  public that the origin of life is a mystery, even though behind closed doors  they freely admit that they are baffled.&lt;br /&gt;&lt;br /&gt;&lt;/div&gt;The computer program that Dawkins wrote to  demonstrate cumulative selection had a population of (probably) 100 “mutant  ‘progeny’ phrases”. In Dawkins’ virtual world the ‘phrases’ took the place of a  population of living things that can breed. Those phrases started out as a  random collection of 28 consecutive capital letters and spaces.  For example a  run might start with the following “phrase”,  “OSYTFJPOPOSICXURQZVBOOYGBWXP”.&lt;br /&gt;The “phrases” do not make sense but Dawkins  did not intend it to make sense at the start of a run. (Whether they should have  or not was ignored by Dawkins).&lt;br /&gt;That program had a “fitness function” and the  purpose of the fitness function was to test to see which of the members of a  virtual population of random ‘phrases’ were most like the same phrase that the  monkey was supposed to type, namely, “METHINKS IT IS LIKE A WEASEL”.&lt;br /&gt;Instead  of trying to get the target in one go, Dawkins computer program was to  accumulate changes over a number of generations until it matched the target  phrase and it did that through the help of the fitness function.&lt;br /&gt;Whichever  one of the “mutant phrases” had the most letters that matched Shakespeare’s  phrase would be chosen to breed the next generation even if it only had one  letter that matched just so long as it was the best phrase.&lt;br /&gt;So just supposing  we started with the random phrase, “OSYTFJPOPOSICXURQZVBOOYGBWXP” and that  phrase had 100 offspring and the following two offspring were compared with each  other&lt;br /&gt;“OSYTFNPOPOSICXURQZVBO YGBSXP” and&lt;br /&gt;“OSTTFNPOPOSICXURQZVBO YGBSXP”. &lt;br /&gt;When the two were compared the second one would win because the third letter  is a “T” and that is a better match of “METHINKS IT IS LIKE A WEASEL”. If that  “phrase” turned out to be the best match in the entire population then that  would be the one that was chosen to produce the entire next generation of 100  mutant phrases. What would happen if we repeated this process over several  generations?&lt;br /&gt;The following shows the results of a run of a program designed  to work in a similar way to Dawkins’ program&lt;br /&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;00:  OSYTFJPOPOSICXURQZVBOOYGBWXP&lt;br /&gt;01: OSYTFNPOPOSICXURQZVBOOYGBWXP&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;02:  OSYTFNPOPOSICXURQZVBOOYGBSXP&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;03: OSYTFNPOPOSICXURQZVBO  YGBSXP&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;04: OSTTFNPOPOSICXURQZVBO  YGBSXP&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;05: OSTTFNPOPOSICXURQZVBA  YGBSXP&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;06: OSTTFNPOPOTICXURQZVBA  YGBSXP&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;07: OSTTFNPOPOTICX RQZVBA  YGBSXP&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;08: OSTTFNPOPOTICX RQZV A  YGBSXP&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;09: OSTTFNPOPOTICX LQZV A  YGBSXP&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;11: OSTTFNPOPOTICX LQZE A  YGBSXP&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;12: OSTTFNKOPOTICX LQZE A  YGBSXP&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;13: OSTTFNKOPITICX LQZE A  YGBSXP&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;14: OSTTFNKOPITICX LQZE A  YEBSXP&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;15: OSTTFNKOPITICX LQZE A  YEASXP&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;16: OSTTFNKOPITICX LQZE A  YEASEP&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;17: OSTTFNKOPITICX LQZE A  YEASEV&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;18: OSTTFNKOPITICX LQKE A  YEASEV&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;19: OSTTFNKOPIT CX LQKE A  YEASEV&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;20: OSTTFNKOPIT CS LQKE A  YEASEV&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;21: OETTFNKOPIT CS LQKE A  YEASEV&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;22: OETTFNKOPIT CS LQKE A  YEASEL&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;23: OETTFNKO IT CS LQKE A  YEASEL&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;24: OETTFNKO IT CS LQKE A  WEASEL&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;25: OETTFNKO IT GS LQKE A  WEASEL&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;26: OETTFNK  IT GS LQKE A  WEASEL&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;27: OETTFNK  IT BS LQKE A  WEASEL&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;28: METTFNK  IT BS LQKE A  WEASEL&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;29: METHFNK  IT BS LQKE A  WEASEL&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;31: METHFNKS IT BS LQKE A  WEASEL&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;32: METHFNKS IT PS LQKE A  WEASEL&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;33: METHFNKS IT IS LQKE A  WEASEL&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;36: METHFNKS IT IS LCKE A  WEASEL&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;37: METHINKS IT IS LCKE A  WEASEL&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;39: METHINKS IT IS LMKE A  WEASEL&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;41: METHINKS IT IS LFKE A  WEASEL&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;42: METHINKS IT IS LYKE A  WEASEL&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;44: METHINKS IT IS L KE A  WEASEL&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new,courier,monospace;"&gt;&lt;br /&gt;45: METHINKS IT IS LIKE A  WEASEL&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;See how  the fitness function was able to help the program to select the letters that  would eventually match the target phrase. That looks impressive but there is a  catch (actually there are a few but I will focus on one here). The problem is  that this fitness function is nothing like “natural” selection. The fitness  function knows in advance where it wants to go but natural selection does not  know where it wants to go, it only knows what it has got to work with right now.  That kind of a fitness function has what is called a predetermined target or  goal. Dawkins himself said&lt;br /&gt;&lt;br /&gt;&lt;div style="margin-left: 40px;"&gt;“Although the monkey/Shakespeare model is useful  for explaining the distinction between single-step selection and cumulative  selection, it is misleading in important ways. One of these is that, in each  generation of selective ‘breeding’, the mutant ‘progeny’ phrases were judged  according to a distant ideal target the phrase METHINKS IT IS LIKE A WEASEL.  Life is not like that. Evolution has no long-term goal.” [emphasis  his]&lt;br /&gt;&lt;br /&gt;&lt;/div&gt;So if Dawkins’ program was only useful for explaining  cumulative selection then it is not an accurate model of what natural selection  can do because natural selection does not have a crystal ball to tell it what  will work better in the future. Any program that has a fitness function that  drives it to a distant ideal target using a “deterministic” fitness function is  “misleading in important ways.”&lt;br /&gt;It’s a bit like a little boy with a toy car,  having pushed his toy car; he then says with amazement, “Look Daddy, it moved!” &lt;br /&gt;William Dembski often refers to “complex specified information.”&lt;br /&gt;Complex  specified information is a key point to this issue so I will give a quick and  non-technical definition of it. The “complex” part of the term implies that the  information content is not small. For instance if you were to tell me that a  monkey had typed the word “CAT’, I would not be impressed because it is not  complex enough since it is only three letters long and so the chances of that  happening are not extremely low. Now if someone sent a radio signal that  contained the Morse code for CATCATCATCATCATCATCATCATCATCATCAT, that would be  far more complex but it would not be “specified” because it contains a repeated  pattern. In fact the “phrase” that I referred to when I talked about&lt;br /&gt;Dawkins  monkey/Shakespeare model “OSYTFJPOPOSICXURQZVBOOYGBWXP” is complex because the  odds of a monkey typing are actually the same as a monkey typing “METHINKS IT IS  LIKE A WEASEL”. But the phrase “OSYTFJPOPOSICXURQZVBOOYGBWXP” is “unspecified”  because it is “random” in other words it makes no sense and conveys no real new  information.&lt;br /&gt;The phrase “METHINKS IT IS LIKE A WEASEL” is specified because  it is using meaningful (though somewhat dated) English words and grammar and  they convey a message.&lt;br /&gt;In chapter 4 of his book “No Free Lunch”, William  Dembski uses mathematics and logic to show that genetic algorithms do not  generate “complex specified information” but borrow the information from the  fitness function. He also shows that the problem of explaining the fitness  function itself is orders of magnitude more difficult to explain so there could  be no way of generating a fitness function without the aid of an intelligent  designer. Since the information is coming from the fitness function in a genetic  algorithm, it is the fitness function that must be explained not the relatively  simplistic target or goal. So genetic algorithms that have targets do not  demonstrate evolution, they just hide the real issues from people who are  unaware of what is really happening.&lt;br /&gt;What Dawkins has failed to do is to  demonstrate that there can be a “continuum” of gradual and progressive steps  that can change an amoeba into a man with or without the help of a “distant  ideal target”. If evolution is as powerful an idea as Dawkins would have us  believe then it would be a simple matter for him to write an “open-ended”  genetic algorithm that does not use either a distant idea target or a human user  to decide what would be chosen by “natural” selection. So genetic algorithms  that have fitness functions don’t help us if we want to learn what “natural”  selection is really like.&lt;br /&gt;&lt;h4&gt;Testing times for evolution?&lt;/h4&gt;One complaint against the theory of  evolution is that there is no way to test it. How could you test it? After all,  doesn’t it take millions of years for evolution to work? Who can wait around  that long?&lt;br /&gt;In his book “Darwin’s Black Box”, Michael Behe talks about a test  for evolution that Darwin himself proposed,&lt;br /&gt;&lt;br /&gt;&lt;div style="margin-left: 40px;"&gt;“If it could be demonstrated that any complex  organ existed which could not possibly have been formed by numerous, successive,  slight modifications, my theory would absolutely break  down.”&lt;br /&gt;&lt;/div&gt;&lt;br /&gt;Michael Behe lists a number of Biochemical (microscopic)  systems that don’t have any obvious step-by-step explanation for their  existence.&lt;br /&gt;Michael Behe calls these systems “irreducibly complex”, in other  words they are too complicated to explain how they came about with “numerous,  successive, slight modifications” because if one part is missing the entire  system would not work so “natural selection” would not select such a system.  Unfortunately evolutionists don’t want to admit that Behe is right so they make  up “just so” stories about how the systems could have evolved without leaving  any actual evidence of how they evolved.&lt;br /&gt;&lt;br /&gt;However, isn’t all of this just  academic? Isn’t there a mountain of evidence in favour of evolution such that it  is no longer a question of if evolution happened as opposed to one of filling in  the details of how it happened? The fossil record and things like anti-biotic  resistant super bugs are two examples of the supposed evidences for evolution. I  don’t have the space to directly response to those arguments but the &lt;a href="http://www.creationontheweb.com/"&gt;CMI website&lt;/a&gt; addresses those issues  and many other supposed proofs of evolution. All I will say here is that the  fossil record is nothing like Darwin expected it to be like and there isn’t just  one missing link, there are huge gaps in the fossil record. In diagrams of the  evolutionary ‘tree of life’ dotted lines are often used to represent gaps in the  fossil record. If you get some whiteout and paint over the dotted lines in the  evolutionary “tree of life” the tree of life looks more like a “creationist  orchard”.&lt;br /&gt;Michael Behe has used the test of Irreducible Complexity to cast  doubt on the theory of evolution and now I would like to suggest that there is  another way that evolution can be tested. What if we could we watch evolution in  action? Not just guessing game evolution but evolution that could think up new  ideas all by itself and even create intelligence as smart or even smarter than  human intelligence? What if we could write a computer program that could do  everything that Darwin talked about? What if we could write one that did not  have an artificial “fitness function”?&lt;br /&gt;You would need a program that  could&lt;br /&gt;&lt;ul&gt;&lt;li&gt;Have things inside it that made copies of themselves.  &lt;/li&gt;&lt;li&gt;Each copy would have, on average, one slight change.  &lt;/li&gt;&lt;li&gt;Each “life form” would be given a certain amount of time to copy itself.  &lt;/li&gt;&lt;li&gt;The ones that were faster at making copies would be more likely to take over  the population. &lt;/li&gt;&lt;/ul&gt;Those steps would be repeated until you saw something  evolve that could do things that could not be done before the start of the  program (or until there has been a reasonable number of generations for that to  happen).&lt;br /&gt;This could happen very quickly on a computer and soon you would have  millions of years worth of generations occurring on a computer.&lt;br /&gt;Sound  familiar? That’s pretty much a repeat of how I described a genetic algorithm  except I haven’t included a fitness function. Genetic algorithms are computer  programs that are designed to simulate evolution on a computer. The main  difference is that this GA would not be designed to solve problems because the  only thing the virtual life forms would have to do is make copies of themselves  and compete for the limited memory inside the computer.&lt;br /&gt;&lt;h4&gt;Tierra &lt;/h4&gt;So now we can test evolution on a computer. We can break  evolution down into its key components, “replication”, “variation” and  “selection”. Replication is the part where something makes copies of itself.  Variation is the part where small changes are made to the copies. Selection is  where the ones that are better at copying themselves survive.&lt;br /&gt;So here is a  test for evolution to see if it can do what evolutionists claim it can do. We  create a virtual world on a computer; in that world we introduce computer  programs that make copies of themselves. We artificially introduce mistakes in  the copying process (but not too many mistakes) and let them compete for limited  computer memory and kill off the ones that are too old and the ones that are not  copying themselves. We watch and see if they can think up new ideas all by  themselves. Sound like a good idea? Well I’m sorry but it’s all a bit too late.  Tom Ray has already thought of it. Who is Tom Ray? Tom Ray is a biologist who  wrote a computer program called “Tierra” so that he could “study evolution” in  “real time”. Tom Ray did not want to wait millions of years for evolution to  take place so he hoped that he could watch it happen on a computer. If you think  that Tom Ray was just a computer programmer who did not know much about  evolution then you would be wrong. If you think that he is a biologist who is  not a good programmer then you would be wrong about that also. Tierra is a lot  more complicated than a quick and simple JavaScript or macro because Tierra  simulates computer hardware. Tierra is extremely “low level”. It should be  sufficient just to say that computer programmers are impressed when another  programmer does something that is “low level”. Tom Ray has earned my respect as  far as his programming skills go.&lt;br /&gt;Well then, Tom Ray must be a billionaire,  right?&lt;br /&gt;Not exactly, Tom Ray has given up on Tierra and gone on to do other  things.&lt;br /&gt;Tom Ray’s dream of creating evolution on a computer has failed to  live up to his expectations. Tom Ray wanted to create “open-ended” evolution but  although Tierra would optimise the computer code by shrinking the size of the  Tierran programs, (except during the runs where he deliberately rewarded the  programs that grew larger), the Tierran programs would get so far and then stop  doing anything new, they would hit what Rodney Brooks refers to as a “glass  ceiling”. The programs that Ray placed in his Tierran world at the start of a  run, would make copies of themselves and that’s all they did and by the time  they had stopped “evolving” they were still making copies of themselves and  that’s all they did.&lt;br /&gt;Even the so-called “parasites” were just segments of  computer code that copied computer code and they did that by cheating (they  borrowed code from other programs and that is not really all that impressive  when you understand the technical details of how they borrowed the code).&lt;br /&gt;In  other words Tom Ray’s Tierra programs did not think up any new ideas or what  could be more correctly referred to as new “function”. It certainly did not  generate what William Dembski refers to as “complex specified  information”.&lt;br /&gt;In case you think that my biased Creationist view can easily be  ignored on this issue, I will point out that Brooks specifically mentions Tierra  and refers to it as hitting a “glass ceiling”.&lt;br /&gt;Brooks would not be inclined  to be so pessimistic unless there were good reasons for him to be.&lt;br /&gt;&lt;h4&gt;What’s missing?&lt;/h4&gt;So what is missing from Tierra?  It has replication; the  virtual “life” forms are computer programs that make copies of themselves. It  has variation since the virus like programs gain a small number of “mutations”  when they are copied. It also has (reasonably) unguided selection; the main role  of the selection function is to check which life forms are making the most  copies and killing off the ones that aren’t. So Tierra has all of the main  components of evolution, “replication”, “variation” and “selection”. The only  things missing are the open-ended evolution and an intelligent designer.  Actually, I think Tom Ray is intelligent and he designed Tierra so it does have  an intelligent designer. Well nothing is missing apart from the expected  results, so why doesn’t Tierra work the way it should? Perhaps the environment  is too simple, perhaps if you had a network of computers then the situation  would be more dynamic and produce more impressive results. Nope, Tom Ray has  already tried that. Well maybe there needs to be something like an environment  that simulates chemistry. Tim Taylor has thought of that. In fact Tom Ray and  others have tried many variations on Tierra and it is the failure of Tierra and  systems like it that prompted Brooks to talk about the need for a few Einsteins  and Edisons to figure out a few things.&lt;br /&gt;&lt;h4&gt;The Alchemy of Computer Science&lt;/h4&gt;So will they ever have a real instance  of evolution occurring on a computer?&lt;br /&gt;The guys at Caltech (Adami et al) think  they have and they would claim that the program that they wrote (Avida) is not a  simulation of evolution but real evolution.&lt;br /&gt;So are they right? Has Microsoft  been put out of business yet? Have computer programmers been put out of a job?  Something isn’t adding up so what is it? The whole problem has to do with “new  information” or “new” function”. Creationists do not claim that things don’t  change; they do not claim that things do not mutate and that the mutations are  never advantageous. What they do claim is that information does not come out of  nowhere. They claim that information always comes from intelligent sources and  not from random mutations and they claim that the advantageous mutations that we  do see really represent either a transfer of existing information or a decrease  in genetic information. In other words the direction of the change is downhill  and not uphill. Genetic Algorithms actually support this view. When a genetic  algorithm solves a problem it doesn’t actually think up anything new by itself,  it does not create new information, it borrows it from the “fitness function”.  That is why people are still employed as computer programmers, they are still  employed because genetic algorithms cannot come up with new ideas all by  themselves, they have to be told what to do and it’s the computer programmers  that have to write the “fitness function”.&lt;br /&gt;Avida is not “open ended” because  Avida works using complicated fitness functions.&lt;br /&gt;Avida cannot keep thinking  up new ideas all by itself in an open-ended fashion.&lt;br /&gt;Avida is a step  backwards (as far as undirected evolution goes). Avida was based on “Tierra”  except they went back to using “distant ideal targets”. All that the “life  forms” in Tierra had to do was to reproduce but since that did not achieve a  great deal, the people at Caltech went back to using a deterministic fitness  function. Bill Gates need not get too worried yet. Dembski equates “the fields  concerned with the emergence of complex specified information” with alchemy. The  goal to create open-ended evolution on a computer is the alchemy of computer  science. You can make gold in a nuclear reactor but you will go broke doing it  (It cost more to make the gold than the gold is worth). You can earn a living  writing genetic algorithms that do have fitness functions but you will not get a  genetic algorithm to write the fitness function for you. You could spend your  entire life trying to simulate truly open-ended evolution on a computer but it  will be a complete waste of time. To get a genetic algorithm to do anything  useful requires a fitness function that is designed to achieve its goal and such  a fitness function requires an intelligent designer.&lt;br /&gt;&lt;h4&gt;Evolution on life support&lt;/h4&gt;Have the Avida guys and Tom Ray been kind  enough to evolution? Perhaps the virtual environment is too harsh. Well not  exactly, in fact they added a number of things that make life very easy for  evolution. This is evolution wrapped up in cotton wool and put on a drip feed.  The virtual life forms don’t need to digest food in order to gain energy. The  entire population doesn’t have any reasonable chance of becoming extinct. The  size of their “DNA” is thousands of times smaller than the DNA in “simple”  bacteria.&lt;br /&gt;That difference in size means it can tolerate a much higher rate  of mutations than living things can and programmers exploit this by setting the  mutation rates to a high setting to speed things up. If real life had a similar  rate of mutation, as the ALife programs do, life would rapidly become extinct  because our DNA would soon become corrupted beyond recognition.&lt;br /&gt;Tierra  provides us with a good example of how ALife programs make life easy for  “evolution”. The Tierran environment is a virtual computer that has a population  of virus like programs that run in it. Those programs use a type of “machine  language” computer code. For those of you who are not programmers a “machine  language” is like a very technical (or low level) nuts and bolts type of  language that the computer chip itself understands.&lt;br /&gt;There is a lot of hidden  function available to the programs in Tierra that is accessed by the power of  the instruction set that is used in Tierra’s machine language. The “Divide”  instruction in Tierra tells the virtual computer to make a completely new  virtual processor (a simulated computer chip) and to have the virtual processor  take control of a child program. That is sort of like the equivalent of using  just 3 letters of DNA to code to build all the machinery inside the cell nucleus  that can make copies of the DNA and that can build important molecules inside  the cell called proteins. In reality it takes thousands of genes to build all  that and genes tend to be thousands of DNA letters long.&lt;br /&gt;All a Tierra program  needs to do to get all of that is guess a number between 0 and 31 (in the 5 bit  version of Tierra). The chance of guessing the right number given a sufficient  number of tries is extremely high and the reward is disproportionately high. The  chance of generating the same level of function in real life using a similar  number of attempts is for all practical purposes zero.&lt;br /&gt;Do you think that any  imaginable “primordial soup” would be anywhere near as kind to life as the ALife  programmers are to their virtual programs?&lt;br /&gt;As far as I’m concerned Tierra  represents a test for open-ended evolution, in the most favourable conditions  possible, and it has failed. I doubt that more complicated systems will produce  genuine open-ended evolution since the Tierran programs failed to exploit the  full potential of instruction set that was available to them. What I mean to say  is that a human programmer would be able to write programs in the Tierran  language that had far more complexity and that were of greater use.&lt;br /&gt;&lt;h4&gt;What do Computer Simulations have to do with the real world? &lt;/h4&gt;By now it  will probably have occurred to you that one major issue is that there is a large  difference between what can happen on a computer and what really happens in the  real world. If you have played computer games for any length of time you will  have probably worked out that the best way to beat a computer is to work out the  weaknesses in the AI of the computer game because you will be able to exploit  those weaknesses time and time again. The computer never learns from its  mistakes (at least not in any of the games that I have played) but most human  players will get the idea eventually. Another issue with computer games is the  “physics”, in some of the games and in some of the flight simulators the physics  will be more realistic than it is in others. For instance in some flight  simulators the introductory level will allow a “pilot” to do things like land an  aircraft on top of a lake (and lots of other very unrealistic things). In other  words the level of realism that is programmed into a simulation limits the level  of realism that you experience when using a simulation. So how similar to real  life are genetic algorithms to real life? The answer is obviously that genetic  algorithms are not very similar to real life at all. So can we learn anything  meaningful about evolution from genetic algorithms? I like to split the problem  into two ways of thinking.&lt;br /&gt;One of the ways of thinking is what I call  “biological” relevance. The other is abstract relevance. Genetic algorithms are  not very useful when it comes to using them as a support for evolution when it  comes to their “biological” relevance. Even if they did manage to get open-ended  evolution occurring in the ultra friendly virtual world of a GA, that would  still be a long way from proving that it could happen in the much harsher real  world. When I mentioned that Tierra like programs could be used to test the  concept of open-ended evolution I was not thinking of its biological or  (real-world) relevance, I was thinking more about its abstract relevance.&lt;br /&gt;So  what is abstract relevance? Abstract relevance is where you break a problem down  into its key components and try to build a mathematical model. You do that in  order to get a proof of concept. We saw that the key components of Darwinian  evolution are replication, variation and unguided selection and that Tierra has  all of those components and yet it fails to be open-ended. Tom Ray is a  Biologist, he knows about the theory of evolution and he modelled Tierra on  Darwinian evolution to the best of his ability, the only reason to question the  accuracy of Tom Ray’s work, at least in an abstract sense, is because you don’t  like the results it has produced.&lt;br /&gt;If the abstract concept of evolution was  ever going to produce complex specified information without the aid of a finely  tuned fitness function it should have happened in Tierra. The Tierran life forms  failed to think up complex ideas that were not handed to them effectively free  of charge from the virtual CPU as well as the powerful instruction set. The real  world is not so kind to evolution so why would one expect open-ended evolution  to be more likely to occur in the real world than in a friendly virtual  world?&lt;br /&gt;If you would like to suggest that it is because the Tierran life forms  are too simple to evolve then consider this. It is incomprehensible how  extremely unlikely that even a “simple” bacterium could have arisen by chance  alone so the chemical evolution people like to think of the first living thing  as being a simple self replicating molecule.&lt;br /&gt;The chemical evolution people  want the first life form to be as simple as possible. The only problem with that  is that the ALife people keep pushing the limit to how simple that can be. It  seems to me that they are at odds with each other because if the ALife people  can’t come up with something open ended that is relatively simple then the odds  of a real-world equivalent forming by chance are extremely small. The more  complex the ALife systems become (without being open-ended) the more of a  concern it should be for Biologists.&lt;br /&gt;Some would say that evolution only  occurs in suitable environments. So that would then raise the issue of how  suitable does it have to be? Is the environment as finely tuned to allow things  to evolve as the physical forces (such as gravity) are? If that was the case  then think about the irony in that, would that not imply that the environment  was designed for evolution?&lt;br /&gt;Research is being conducted into genetic  algorithms and artificial intelligence in Universities all over the globe,  brilliant minds like Rodney Brooks, Karl Sims, Chris Adami, Tim Taylor, Tom Ray  and Paul Marrow have worked on the problems for years.&lt;br /&gt;Is it not time to  start asking some tough questions about evolution?&lt;br /&gt;&lt;h4&gt;Conclusion - Never say never?&lt;/h4&gt;Naturally enough evolutionists have not  given up on open-ended genetic algorithms and they are not likely to give up any  time soon.&lt;br /&gt;The theory of evolution strongly influences their thinking and  they have an “a priori” commitment to a naturalistic explanation for life. The  theory of evolution has had many challenges and every time evolutionists will  just make up add hoc explanations to accommodate what is actually observed, so  it is hard to imagine that much will change in the near future.&lt;br /&gt;I want to  re-iterate something here just in case I haven’t made the point clear enough.  Genetic algorithms that have a fitness function can do some very useful things;  in fact, if I had to write an application that favoured that approach then I  would consider using a GA myself (obviously the design would include a fitness  function). The only time I have a problem with genetic algorithms is when  someone tries to use them as proof of evolution (whether the proof be stated or  implied.) Since genetic algorithms do not generate new complex specified  information, they cannot be used in support of molecules to man evolution. &lt;br /&gt;But what will happen with ALife and artificial intelligence in the future?  With the amount of time being spent on them, they will get better and the  results will be more amazing and it will get harder and harder for creationists  to analyse what is actually happening. The programmers themselves will think up  new ways of introducing information (new function) into a system without  realising the real implications of that to the theory of evolution. So I predict  that (useful) genetic algorithms will always have fitness functions but that the  programmers will get good at hiding it (even from themselves). &lt;br /&gt;Two  potential ways that it could be achieved is 1. Optimising the way that fitness  functions are defined (using what programmers call a higher level language to  describe what the goal of the GA is – this would make them easier to program) 2.  Being able to introduce fitness functions as plug-ins while the GA is working in  “real time”.&lt;br /&gt;There may well be other ways that a GA can “learn” (extract  ideas from an external source) while it is still running.&lt;br /&gt;But can I  categorically say that they will never invent a truly “open-ended” genetic  algorithm that uses real evolution to design new ideas without any help from a  programmer? The problem is that the question itself seems in some respects to be  open-ended because evolutionists can just invent some mystery component that  Darwin was not apparently able to recognise and tell us that a few Einsteins  will figure it out in the future.&lt;br /&gt;&lt;br /&gt;Here’s what Brooks says (In “Flesh and  Machines: How Robots Will Change Us”) about the problems of building open-ended  genetic algorithms and smart robots.&lt;br /&gt;&lt;br /&gt;&lt;div style="margin-left: 40px;"&gt;There are a few hypotheses we could make about  what is lacking in all our robotic and Alife models.&lt;br /&gt;1. We might just be  getting a few parameters wrong in all our systems.&lt;br /&gt;2. We might be building  all our systems in too simple environments, and once we cross a certain  complexity threshold, everything will work out as we expect.&lt;br /&gt;3. We might  simply be lacking enough computer power.&lt;br /&gt;4. We might actually be missing  something in our models of biology; there might indeed be some "new stuff that  we need.&lt;br /&gt;&lt;/div&gt;&lt;br /&gt;Brooks goes on to argue against the first three  explanations and then talks about the “new stuff” that he latter refers to as  some mystery thing called “the juice”.&lt;br /&gt;He thinks that “the juice” might be a  kind of mathematical algorithm that will require a few “Einsteins or Edisons to  figure out”.&lt;br /&gt;&lt;br /&gt;While the question about whether they can produce open-ended  evolution on a computer seems open-ended in itself, it seems to me that the  issue is already solved but that evolutionists don’t want to accept the  implications.&lt;br /&gt;Tom Ray’s Tierra or a more complex derivative of it (that does  not have a fitness function) should have done something impressive by now if it  was ever going to. The computing power of linked computers over the Internet or  in super computers is unimaginable so that is not the issue any more. Tom Ray’s  algorithm lacked none of the elements of Darwin’s theory. My conclusion is that  at best Darwinian evolution is an incomplete theory and it has been demonstrated  to be so on a network of computers.&lt;br /&gt;Newton’s work on gravity and motion has  been shown to be incomplete and yet we have satellites in space. Einstein’s  theory of “General Relativity” is considered to be incomplete and yet some of  those satellites are GPS satellites and GPS satellites take relativity into  account when they perform their calculations. Newton and Einstein have come up  with theories that work in the real world. Darwin’s theory of evolution is  supposed to have explained how living things are meant to have evolved from a  “simple” living cell into people and how it was able to think up new ideas along  the way without the help of a few Einsteins or Edisons. Yet Brooks admits that  evolution on a computer is not open-ended and he talks about the need for a few  intelligent designers. How then could life have evolved in the real world  without the aid of an Intelligent Designer?&lt;br /&gt;&lt;br /&gt;In summary the situation as  it stands is&lt;br /&gt;&lt;br /&gt;No fitness function = no evolution.&lt;br /&gt;No programmer = no  fitness function&lt;br /&gt;&lt;br /&gt;therefore&lt;br /&gt;&lt;br /&gt;No programmer = no evolution.&lt;br /&gt;&lt;br /&gt;Dr  Don Batten and I wrote an article about Dawkins’ &lt;a href="http://www.creationontheweb.com/weasel"&gt; “monkey/Shakespeare” program&lt;/a&gt;  that discusses more of the shortcomings of computer simulations of  evolution.&lt;br /&gt;See also &lt;a href="http://www.creationontheweb.com/weaselwords"&gt;“Weasel Words”&lt;/a&gt; and this  article on &lt;a href="http://www.creationontheweb.com/ga"&gt;Genetic  Algorithms&lt;/a&gt;.&lt;br /&gt;Dr Don Batten is a qualified scientist so he had the final  say in the wording that was used in the article that he wrote together with me.  I am not and have never been an accredited speaker for any creation ministry and  the views that I express on this website are my own.&lt;br /&gt;&lt;br /&gt;I believe that  evolution is unnecessary since an all-knowing; intelligent Designer would not  need to use evolution. I believe that the evidence points to God who created  life as recorded in the Bible.&lt;br /&gt;The lack of open-ended evolution in computer  simulations is caused by the inability of genetic algorithms to generate new  complex specified information. That confirms Dembski claims about complex  specified information.&lt;br /&gt;Don’t hold your breath waiting for the “new stuff”  that Brooks talked about and don’t waste you life looking for the elusive pot of  gold at the end of the virtual rainbow.&lt;br /&gt;&lt;br /&gt;The only real alternative to  evolution is creation. I believe that God created the Universe and that he did  that so that we would have the opportunity to get to know him.&lt;br /&gt;Please think  about asking God to reveal himself to you. Knowledge is useful to help us  understand many things about the “natural” world but we will never know  everything because our knowledge has limitations. But God is not limited  consequently he is able to reveal himself to you and to change your life for the  better. The Bible says if you seek you will find; if you seek God with all your  heart you will find him. There is &lt;a href="http://www.leslieey.com/evidence.html"&gt;evidence&lt;/a&gt; that Jesus was a real  person and that he rose from the dead.&lt;br /&gt;If you want to become a Christian  please see my &lt;a href="http://www.leslieey.com/gospel.html"&gt;“How do I become a  Christian?”&lt;/a&gt; page.&lt;br /&gt;&lt;h4&gt;Acknowledgements.&lt;/h4&gt;I would like to acknowledge the inspiration and help  of Dr Don Batten and Stephen Tuggy while I’ve been researching Genetic  Algorithms.&lt;br /&gt;William Dembski’s book “No Free Lunch” would be of interest to  anyone with a high level of mathematics.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1479329177592025809-716746471859132102?l=les-ey.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://les-ey.blogspot.com/feeds/716746471859132102/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=1479329177592025809&amp;postID=716746471859132102' title='1 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1479329177592025809/posts/default/716746471859132102'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1479329177592025809/posts/default/716746471859132102'/><link rel='alternate' type='text/html' href='http://les-ey.blogspot.com/2007/05/does-evolution-need-few-intelligent.html' title=''/><author><name>Les</name><uri>http://www.blogger.com/profile/05561653336505981873</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>1</thr:total></entry><entry><id>tag:blogger.com,1999:blog-1479329177592025809.post-3372766765238909662</id><published>2007-05-23T00:51:00.001-07:00</published><updated>2007-05-23T01:10:34.447-07:00</updated><title type='text'>Hi</title><content type='html'>Hi I'm a Software Engineer from Adelaide South Australia&lt;br /&gt;&lt;br /&gt;I have a formal website &lt;a href="http://www.leslieey.com/"&gt;www.leslieey.com&lt;/a&gt; but I often would like to publish thoughts that are less formal or more technical than I consider suitable for my other website.&lt;br /&gt;&lt;br /&gt;I'm an &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_0"&gt;armature&lt;/span&gt; photographer and I have some photos posted on &lt;a href="http://www.panoramio.com/user/465948"&gt;&lt;span class="blsp-spelling-error" id="SPELLING_ERROR_1"&gt;panoramio&lt;/span&gt;&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;and &lt;a href="http://www.flickr.com/photos/8367782@N07/"&gt;&lt;span class="blsp-spelling-error" id="SPELLING_ERROR_2"&gt;flikr&lt;/span&gt;&lt;/a&gt;&lt;br /&gt;&lt;br /&gt;Many people feel uncomfortable about discussing religion and I can understand why but then again it saddens me that it should be like that.&lt;br /&gt;My view is that Christianity is not about religion, I believe that it is about a relationship with the Creator of the Universe. I believe that He was &lt;span class="blsp-spelling-corrected" id="SPELLING_ERROR_3"&gt;revealed&lt;/span&gt;  to us through &lt;a href="http://www.leslieey.com/jesus.html"&gt;Jesus Christ&lt;/a&gt;.&lt;br /&gt;&lt;br /&gt;My formal website was set up to offer searching people the opportunity to find out about Jesus if they want to.&lt;br /&gt;&lt;br /&gt;God bless,&lt;br /&gt;Les&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/1479329177592025809-3372766765238909662?l=les-ey.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='replies' type='application/atom+xml' href='http://les-ey.blogspot.com/feeds/3372766765238909662/comments/default' title='Post Comments'/><link rel='replies' type='text/html' href='http://www.blogger.com/comment.g?blogID=1479329177592025809&amp;postID=3372766765238909662' title='0 Comments'/><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/1479329177592025809/posts/default/3372766765238909662'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/1479329177592025809/posts/default/3372766765238909662'/><link rel='alternate' type='text/html' href='http://les-ey.blogspot.com/2007/05/hi.html' title='Hi'/><author><name>Les</name><uri>http://www.blogger.com/profile/05561653336505981873</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><thr:total>0</thr:total></entry></feed>
